Chapter 266 of 291

Book 4 Chapter 30: Redemption Arced

Vell Harlan and the Doomsday Dorms4,421 words~23 min read

“Earplugs in?”

Nobody reacted. Freddy realized his mistake. He raised his voice to a shout.

“Earplugs in?”

This time everyone nodded affirmatively. Some double-checked their earplugs were sealed, and then gave the thumbs-up.

“Okay then, any hearing damage beyond this point is your own fault,” Freddy said. “Alex, on my mark. Three, two, one…”

Freddy gave the signal, and Alex cast the spell, creating portals in the middle of their sealed testing area, on either side of a small launch ramp. She held the opening steady as a small rocket fired and flew through the portals. The platform retracted right afterwards, allowing the rocket to fly in a loop between the two portals, flying in one and right out the other. Alex moved her hands slightly closer together, magically closing the gap between the two portals until they were mere centimeters apart. The rocket traveling between them burned brighter and brighter, accelerating inside the closed loop.

Freddy covered his ears, just to be sure, and his friends did the same. With a nod to Alex, she dropped both the portals.

Whatever happened next was so fast nobody could see it properly with the naked eye, but in the aftermath, the test rocket had completely vaporized itself on a steel plate, leaving only a smoking black smear where it had impacted.

“Neat,” Samson said. He took his fancy earplugs out. “Was there a reason for that beyond obliterating a toy rocket?”

“Reduced friction acceleration,” Freddy said. “That could be very useful for building space elevators and the like. Depending on the data. There was no sonic boom, which was promising.”

“That could be a result of the scaled-down size, though,” Alex said. “We’ll have to do a large scale test some other time.”

“We’ll save that for an aeronautics company, we’re just working on the theory right now,” Freddy said. “Unless you think Harlan Industries has the budget for a supersonic jet, Vell?”

“We could maybe buy you a ticket on someone else’s supersonic jet,” Vell said. “One-way.”

Their budget had been worked down to the bone already setting up the R&D department Vell would soon take charge of, and that Freddy would soon be working in. He was one of the handful of soon-to-be-graduates Vell knew who’d taken him up on the offer of employment.

“We’ll stick to theory for now,” Freddy said. “But we can save parsing the data for tomorrow.”

“Maybe over lunch?” Alex suggested, trying not to blush as she spoke.

“I’ve got to call home at lunch,” Freddy said. “We’ll have to do it in lab hours.”

“Okay.”

“Right now I think I could go for dessert,” Freddy said. The experiment had taken most of the day to set up, so it was already after dinner. “Anybody want some ice cream?”

“Sounds good,” Hawke said. “I could go for some-”

Kim put him in a chokehold mid-sentence.

“We have something to do,” Kim hissed.

“We do?”

Kim forcibly jerked Hawke’s head towards Alex, who was glancing nervously between Freddy and the other spectators.

“Oh, we do,” Hawke said. “Right. Maybe some other time, Freddy.”

Kim released the chokehold, and they hustled right out of the room. Samson watched them go.

“What have they got going on?”

“The same thing as us,” Vell said, as he snatched Samson and dragged him out of the room in turn. Freddy did not find this suspicious at all, given some of the loopers’ past behavior. His only instinct was to turn to Alex.

“You’re heading out too, I assume?”

“No.”

“Really?”

“I’m not involved in every weird thing they do,” she said.

“Could’ve fooled me,” Freddy said.

“I would like to be involved in some ice cream, though,” Alex said. “If that’s alright with you.”

“Why would it not be?”

He put away the last of the experiment supplies and shouldered his bag, then headed out. Alex walked next to him, but not exactly next to him, because matching him step for step would be weird. She briefly walked a little ahead of Freddy, and then wondered if that made her look too domineering, so she slowed down to walk behind him, and then worried that might make him lose track of her, so she subtly alternated her pace so that she would be next to him for two steps, and then shift slightly behind but still be visible out of the corner of his eye, but not fall so far behind he’d lose track.

“Are you alright, Alex?”

“Fine!”

“You’re walking funny, is all.”

“Earplugs threw off my inner ear equilibrium,” Alex snapped.

“That’s...they shouldn’t do that,” Freddy said. “I’ll have to adjust the equipment.”

“No the equipment’s fine I’m just weird,” Alex said.

“Correct,” Freddy said. Alex let out a single nervous chuckle. She rode the high of that friendly banter until they made it to the dining hall and took their seats. Alex was more confident in her ability to sit normally. She’d been practicing.

Freddy ordered their desert through an app, and a delivery drone dropped two bowls of ice cream right in front of them.

“Excellent work on the portals today,” Freddy said, between spoonfuls. “Most people can’t hold them together under that kind of kinetic stress.”

“It wasn’t my first rodeo,” Alex said. She’d had to pull a similar trick to trap a sentient bullet a few apocalypses ago.

“We hang out with Vell, I think we’ve all been to several rodeos by proxy,” Freddy said. Alex nodded in agreement.

“I’ve also been to a few actual rodeos,” Alex said.

“Really?”

“Yeah. I’m from Montana, remember? Surprisingly strong rodeo scene up there.”

“You enjoy them?”

“No, there just wasn’t a lot else to do near the reservation,” Alex said.

“Hmm. I see why you hit the books so much.”

“Oh, that was...something else,” Alex said. Her parents had always stressed the importance of doing good in school, even to the detriment of everything else. Freddy had dealt with enough messed up people to recognize trauma when he saw it, so he did not push the issue.

“So, any other hobbies?”

Alex was glad to take the change of subject, even if it wasn’t much of a subject. She actually didn’t do much. Thankfully they pivoted to Freddy’s hobbies soon enough.

“I’m really looking forward to final’s being over,” Freddy said. “I have a lot of anime to catch up on.”

“You know, I never really got anime,” Alex said. “It just seems like a lot of people screaming at each other and fighting.”

“Oh there’s way more to it than that.”

More than once, Alex had wondered if her attraction to Freddy was genuine, or if she had just latched on to his act of kindness, and she was pleasantly surprised to find objective proof that her feelings were real. Only genuine attraction could possibly survive a ten-minute rant about different types of anime.

“I’ll get you to watch Baccano sometime, you’ll get it,” Freddy said, concluding his rant.

“I’d like that,” Alex said, and she genuinely meant it. “We could try and find a night to watch a few episodes, at least.”

“Maybe, but you know how hard it is to get everyone together,” Freddy said.

“Well, I didn’t mean everybody,” Alex said. “More like...just you and me, maybe?”

“Oh, like…”

Alex and Freddy made eye contact, and froze solid as the remnants of their ice cream melted. Both of them were equally terrified about what the next few words of that sentence would be. Somehow, that was more comforting than any amount of encouragement or coaching ever could’ve been.

“A date, yeah,” Alex said. She ate a spoonful of ice cream just to have an excuse to hide her growing smile.

For a second, Freddy’s face went completely blank. Alex got the feeling his heart and brain had both stopped. Then he blinked, and everything started working again.

“Yeah. I’d like that.”

“Okay. Okay! Uh, tomorrow, then, at dinner, maybe?”

“Yeah, I can free up an hour or two,” Freddy said. “That works.”

“Good.”

Alex nodded, and Freddy nodded. Then they stared at each other for a second. Both of them started to go red in the face.

“I don’t know what I’m supposed to do now,” Alex said.

“Neither do I. This has never happened to me before,” Freddy mumbled.

“Should I leave? Would that be rude?”

“One of us has to leave eventually, we can’t just sit here all night,” Freddy said.

“Okay, and I just leave, I don’t have to shake your hand, or kiss you on the cheek, or something?”

“I think you could’ve but it’d be weird to do that now,” Freddy said.

“Right. Leaving now, bye!”

Alex stood up and zipped around the corner, out of sight, before poking her head back around the corner.

“I’ll see you tomorrow! At our date!”

“Yeah, see you then.”

Alex turned and fled, thinking all the while of just how stupid that entire exchange had been.

----------------------------------------

“Genome sequence of the Kisslip Cuttlefish?”

The story has been taken without consent; if you see it on Amazon, report the incident.

“TATGTCAATGACACAATTATTATT,” Skye said, without any hesitation. Vell checked her textbook and found she was correct. “Okay, my turn.”

“Correct order for the Ephram-Miller ‘Bouncy Ball’ rune sequence?”

“Sphere-energy/impact-capture-reverse-expel,” Vell said.

“I feel like that one was easier than mine,” Skye said.

“I didn’t write the tests,” Vell said. With finals only a few weeks away, they had made a game of their nightly study sessions. They quizzed each other, and whoever got a question wrong first had to make coffee in the morning. They were mostly even so far, but Vell had been on a winning streak the past few days, one Skye was determined to break.

“I’m going to have to look for a hard one next,” Skye said. She perused the study guide and looked for a real challenge, right up until someone knocked on the door. “Oh, maybe our next question can be ‘who’s bothering you this time’?”

“I already know,” Vell sighed. He stood up, opened the door, and let Alex nearly tumble through it.

“Vell! I need your help!”

“Of course you do,” Vell said. “What happened?”

“I asked Freddy on a date!”

“Oh god, did he turn you down?”

“No!”

Vell put both his hands together as if in prayer, held them to his lips for a moment, and then pointed them towards Alex.

“I’m sorry, I’m confused,” Vell said. “Was this not the goal?”

“I’ve never been on a date before, Vell,” Alex said. “What happens when I mess it up?”

“You mess it up,” Vell said with a shrug. “Look, Freddy likes you well enough to go on a date, all you have to do is be the same version of yourself he already likes. Stressing about it or trying to change at the last minute is going to make things worse, not better.”

“That’s...that’s probably right.”

“You’ll be fine,” Vell assured her. He put a hand on Alex’s shoulder for a little extra reassurance. “Just-”

There was another knock on Vell’s door. He looked up at the door and sighed.

“Hi Freddy.”

“How did- Alex is here, isn’t she?”

“Hi,” Alex squeaked. Freddy poked his head through the door and beamed with an awkward smile.

“Great minds think alike, I guess.”

“And apparently they think of borrowing someone else’s mind,” Vell said. “Look, you’re obviously both equally nervous about this, just go in understanding you’re both awkward and be willing to overlook a bit of stammering and some sweaty palms, alright?’

Freddy and Alex shared an awkward glance and nodded in unison.

“Okay, great, glad we have an understanding,” Vell said. “Now, final note, I have been trying to be a little more assertive, would you two mind if I practiced something on you?”

They both nodded again.

“Great, thanks,” Vell said. He threw both hands towards the door. “Get out of my dorm!”

Alex gave a quiet yelp of surprise and scampered out the door. Whatever awkwardness ensued between her and Freddy once she was out the door was not for Vell to know, nor to care about. He returned to the couch and plopped down next to Skye.

“I think you could’ve upped the volume a bit, but that was very good,” Skye said.

“Thanks,” Vell said. “I have no idea why they came to me for relationship advice in the first place. I mean, me?”

Skye gestured to herself with both hands. She certainly considered their relationship worth emulating. They’d made plans to move in together after graduating only days ago.

“You have been way more patient with me than I deserve,” Vell said. “If you weren’t so cool I would’ve fucked this up ages ago.”

“Don’t sell yourself short, handsome,” Skye said. “Most guys would’ve dumped me after I accidentally made them grow scales.”

“You got rid of them,” Vell said. It had been a very itchy half hour, but only half an hour. “Now, where we were on the tests?”

“We were at the part where I finally outwit you,” Skye said. She gave him a quick kiss on the cheek, and the testing resumed.

----------------------------------------

Alex nearly tripped over herself as she scuttled to the loopers usual spot for breakfast. The dining hall was less crowded today, giving her plenty of room to recover as she stumbled.

“I see sleeping on it has done nothing to help your nerves,” Vell said. He sipped at a cup of coffee he’d made that morning.

“If anything, it’s now worse,” Alex said. “I realized that today is an apocalypse!”

“So?”

“So disaster will almost certainly strike right in the middle of my date,” Alex said.

“Why would that happen?”

“It always happens! The stories you’ve told me about the incidents with Caesar’s ghost and cursed Khmer warriors and the living paintings alone-”

“Alex, those were isolated incidents, I have gone on dozens of dates with Skye with literally no problems,” Vell said. “I just don’t tell you about them because they’re not interesting.”

“But it’s a first date, something’s bound to go wrong!”

“I have also been on first dates with no incident,” Hawke said. Samson nodded as well. Neither of them had found a long-term relationship, but they had gone on occasional dates, all entirely without ghosts or ghouls of any sort.

“But it’s my first date. Ever!”

“Do you think the universe cares enough about you to go out of its way to ruin your day?”

“Yeah, it only does that for Vell,” Kim said. Vell paused mid-sip to glare at her, but he had no rebuttal.

“It hasn’t exactly been kind to me before,” Alex mumbled.

“First of all, champ, a significant amount of your problems have been your own fault,” Kim said. “Don’t blame the universe for you being a bitch. Secondly, I can guarantee the daily apocalypse isn’t going to interfere with your date.”

“How can- Ah,” Alex said. “Should I bother turning around?”

“Oh, you’re fine, it’s just a bunch of little dudes,” Kim said.

Alex turned around and saw a small army running towards them. Small in that there were only a hundred or so, and small in that they were about six inches high. The horde of miniature people in Victorian finery scrambled past in a hurry, shouting something about eggs as they ran.

“That didn’t seem very apocalyptic,” Alex said.

“Not on their own,” Vell said. “Those were Lilliputians. They’re mean little bastards, but the real problem is-”

A looming shadow fell over the entire dining hall as a towering humanoid frame stood between it and the sun.

“-the Brobdingnagians,” Vell said. “Who are very, very large bastards.”

The colossal figure reached through the wall, tearing through it as if it was no sturdier than paper, and then snatched up a handful of students. It examined them as if they were dolls, and then discarded the ones it didn’t like, throwing them seventy feet to the ground.

“I always like an early morning apocalypse, really frees up the rest of the schedule,” Vell said, as he readied his guns.

----------------------------------------

Kim slammed the copy of Gulliver’s Travels shut, and put it back on the shelf with the rest of the library books. Hawke looked on and nodded in admiration.

“How’d you fit that big guy back in the book anyway?”

“Lot of elbow grease,” Kim said.

“Like, figuratively, or do you have literal grease in your elbow?”

“It was figurative, but come to think of it, I could use a good lube,” Kim said. She flexed an arm that had undoubtedly been worn down by wrestling fictional characters back into the book where they belonged. “Good thing to do while we’re inside avoiding Alex all day.”

“Oh good, we’re on the same page about that,” Hawke said.

“Yep. Against all odds, I have actually started to sort of like Alex,” Kim said. Now that she was not being such an asshole about everything, Alex’s self-centered cluelessness was almost endearing. “I’m not going to jeopardize that progress by having her be a nervous wreck around me all day.”

“Hard agree,” Hawke said. “Mind if I go get some snacks and I can spend the rest of my day pretending to help you with maintenance?”

“I was going to invite you anyway.”

----------------------------------------

Alex ran the mental checklist in her head. Nobody had gotten hurt, no damage had been done to any property, and Freddy still seemed to be happy spending time with her. They had a lovely conversation over dinner, laughed at each other’s jokes, and she was even enjoying the strange japanese cartoon Freddy was having her watch, though it had taken her a while to figure out the multiple ongoing timelines. Objectively speaking, the date was going great.

Internally, Alex was trapped in an inescapable nightmare. Every moment was a torrent of anxiety, as she wondered if she was sitting too close or too far, laughing too much or not enough, if her clothes were right, if her hair was right, if anything she was doing was right or if it was all a complete disaster. Alex had never been more nervous or more happy.

The latest episode wrapped up, and Freddy checked the time.

“I think we’re cutting it a bit close,” Freddy said. Both had carved time out of their busy schedules for the date, and that time was starting to run out. “We’ve still got a few minutes, I guess, if you want to, uh, talk.”

“I do like talking to you,” Alex said. Then she mentally slapped herself in the face. “Sorry, that was weird.”

“No, I get it,” Freddy said. “I needed to hear that, I think. I’m so nervous I worry I’m being awkward.”

“Well you’re not,” Alex said. “Am I?”

“Nope.”

Alex made a mental note of that.

“Then...do you want to do this again sometime?”

“Does Thursday work?”

“Thursday works,” Alex said. “Goodnight.”

“Goodnight.”

Alex stepped out of the room, red in the face. She stood just outside the door and stared blankly ahead.

“Is that it?”

----------------------------------------

“If you were expecting a kiss, that usually doesn’t happen on the first date,” Vell said, without taking his eyes off his textbook.

“I wasn’t,” Alex said. “I was just expecting something more...something. At all.”

“Love isn’t usually one of those explosive dramatic surge feeling thingies,” Kim said. “If it is, there’s a non-zero chance you’ve been brainwashed, so you should be skeptical of feeling like that.”

“Congratulations on your perfectly normal date, and the beginning of a perfectly normal relationship,” Vell said. “We should all be so lucky.”

“Just based on historical trends, I expected some kind of calamity,” Alex said. “An apocalypse, interference from Kraid, a scheduling conflict, at the very least.”

“If you really want your dates to be ruined that badly, I could third wheel your next dinner and chew with my mouth open,” Samson suggested.

“I’m not asking for trouble, it’s just weird that it didn’t happen,” Alex snapped.

“I kind of get it,” Hawke said. “Kind of.”

“Well then I will take my ‘kind of’ sympathy and quit while I’m ahead,” Alex said. She grabbed her things and headed out. “I’ll see you all at the daily disaster.”

“Adios, muchacha,” Kim said. She saluted as Alex left the room and headed across the quad.

The school was bustling with students headed between classes and tests and homework and meals, just like always. Everything was completely normal.

Out of curiosity, Alex cast a simple light spell. Without a single spark of gray on her fingertips, the magic orb coalesced into a deep emerald green glow. A few shades darker than the bright green magic she’d originally had, years ago, but perfectly stable and healthy. It felt strange, and Alex didn’t understand why.

But there was only one person who might sympathize. Alex headed for the senior dorms, and the room that had once been Skye’s, but now belonged to Joan Marsh. Alex knew the code, but she knocked on the door anyway. And then knocked again a minute later. She could hear motion inside the dorm now, so she waited for the extra minute it took Joan to actually answer the door. When she did, the wrinkly clothes she wore and the haphazard tangle of her hair made it clear she had just gotten out of bed.

“Sorry, sorry, I just- You’re not Ming.”

“Who is Ming and why would I be them?”

“I’m tutoring some first year dudes,” Joan said. Her knowledge couldn’t compete with students of later years, but she knew enough about the first year curriculum to help others. She checked the time and realized she had not actually slept through her scheduled appointment and sighed with relief. “Anyway, what’s up, Lex?”

“I wanted to talk about something, if you have the time,” Alex said.

“I very clearly have the time,” Joan said, gesturing to her unkempt appearance. “But do you have the time to let me take a shower before we have any heart to hearts? It’s hard to take life advice seriously when it comes from someone greasy.”

“I concur,” Alex said. She also smelled a little, but Alex had learned it was not polite to mention that. “Go ahead.”

Joan closed the door, and Alex waited patiently for the several minutes it took her to finish her shower. She was still visibly damp when she opened the door again, but it was an improvement over being entirely unwashed.

“Okay, good to go,” Joan said. She beckoned Alex inside and took a seat on the couch. “What’s eating you, Alex?”

“Well, I went on a date with Freddy last night…”

“I heard,” Joan said. “He was very excited about it.”

“And I was excited too! It just feels...I don’t know, like there should be more,” Alex said. “Like I needed to do more to earn it, or there should be more reactions, or something, I don’t know!”

Alex could not articulate her feelings at all, which made it all the more surprising that Joan nodded in understanding.

“Oh, yeah, I get it,” Joan said. “Welcome to maintenance mode.”

“Maintenance mode?”

“Yep, maintenance mode,” Joan said. “I had the same feeling, especially after I started dating Lee. After months of hard work and personal growth, you’ve reached the exact same level as the average person. You’ve crossed your last milestone, no more huge hurdles, and no more pats on the back.”

“But I still have to put so much work into everything,” Alex said. Though she had learned to control the impulses, her first instinct was usually to fall back on her same old rude, self-centered behavior.

“I know that and you know that, but nobody else is going to know that,” Joan said. “The battle’s entirely internal from here on out, and nobody’s going to appreciate how hard it is. Except maybe Vell. He’s weirdly sympathetic.”

“But what if I still need help?”

“Then you ask for it, like you’re doing right now,” Joan said. “But the only thing you’ve done is learn how to not be an asshole, and the average person is not an asshole all the time. As far as anyone else is concerned, you’re just a regular joe now.”

“I suppose there are worse things to be,” Alex said.

“Yep. We could still be assholes,” Joan said with a chuckle. “Just take it slow. Remember what you’ve learned, and be patient with yourself. You’ll be fine.”

“Thanks,” Alex said. “I do have one related question, also, if that’s alright?”

“Sure, I’ll answer any questions you got,” Joan said. In spite of that promise, it took Alex a few seconds to muster the nerve to ask her question.

“How many dates am I supposed to go on before...well, you know,” Alex mumbled.

“Never mind, I will not answer those questions,” Joan said.

“But-”

“But nothing, I am not your sex coach.”

“I was talking about kissing!”

“That’s still weird,” Joan said. “Just, I don’t know, you’ll know when the time is right. And maybe ask Freddy before you do it. Warn him at least, jeez, he’d probably have a heart attack if you took him by surprise.”

“Okay. And when I do, how do I-”

“No, nope, not going there,” Joan said. “Lifecoaching session over, I’m back to being an asshole.”

“But I don’t know what to do!”

“You’re smart, you’ll figure it out,” Joan said. “Now I got to get ready for a tutoring session, so excuse me.”

“Fine, I can take a hint,” Alex grunted.

“This is only partially a deflection method, I overslept by like two hours,” Joan said. “I would appreciate some time to prepare.”

“Oh, sorry. I’ll get out of your hair.”

Alex left, but she was slightly suspicious about the speed with which Joan shut the door behind her. She stood for a second, wondering what to do next. Hopefully something normal.

A nearby window crashed open, and Kim crashed through in a shower of broken glass and rubble. She laid on the floor for a second and looked up at Alex.

“Hey Alex,” Kim said. She had a small dent in her chin. “There’s some fruit punch out there with some very literal punch. You in?”

Alex nodded, and her hands flared with deep green light. Kim jumped right back out the hole in the wall, and Alex followed. She’d learned to be a lot more normal, but she’d never be that normal.

Contents
Contents